Sabit disk yerine bakteri

Genç araştırmacıların tasarımı, bakteriler üzerine veri depolamayı mümkün kılıyor.

ntvmsnbc
Güncelleme: 14:47 TSİ 29 Kasım. 2010 Pazartesi
Tüm bir bilgisayar diskini dolduran bilgiyi DNA dizilimi şekline dönüştürerek E. coli bakterisi içinde saklamak mümkün. Bu tip mikroorganizmalar içinde veri saklama fikri yeni olmasa da ‘Uluslararası Genetik Mühendisliği Ürünü Makine’ yarışmasının 2010 yılı katılımcılarından Hong Kong’lu ekip bunu pratiğe dökebilmiş. En basit bakteriler bile binlerce bazdan meydana gelen uzun DNA zincirlerini barındırabiliyor ve bir sabit diskten çok daha dayanıklılar. Üstelik bakterilerin doğal çoğalma yetenekleri mevcut verinin istenildiği kadar kopyasının alınmasına olanak sağlıyor.
Veriyi bir bakteri içine yerleştirmek için uygulanacak basamaklar oldukça basit. DNA dizilimini oluşturmak için adenin, guanin, sitozin ve timin adı verilen dört bazdan yararlanılabiliyor. Bu da dört tabanına uyan bir sistemle çalışmak zorundayız anlamına geliyor. Çevirme işlemi ise şöyle yapılıyor:
Örneğin ‘i’ harfini ele alalım. Latin alfabesi üzerine kurulu 7 bitlik bir karakter seti olan ASCII tablosunu kullanarak her harfin rakamsal karşılığını elde edebiliyoruz. Buna göre i harfinin karşılığı 105 oluyor. Bu rakamı da onluk tabandan dörtlük tabana çevirdiğimizde 1221 sayısını elde ediyoruz. Dörtlük sistemde her rakamın karşılığı olan bazlar şöyle: 0=A, 1=T, 2=C, 3=G. 1221 sayısını da bu eşitliğe uyguladığımızda TCCT dizilimi karşımıza çıkıyor.  Bu sisteme göre NTV BİLİM kelimelerinin karşılığı olan dizilimse şöyle: ‘TAGCTTTATTTCACAATAACTAGAATAGATAGAATAGT’.
Ham verilerin elde edilmesinden sonra kullanılacak bazı algoritmalarla kıslatmalar yapmak da mümkün. Böylece sadece belirli bir kısaltma yapılmakla kalmayıp canlıya biyolojik açıdan zararlı olabilen fazla sayıdaki tekrarlı dizilerden de kurtulmuş olunuyor. Eğer bir bakteri veriyi depolamak için tek başına yeterli gelmiyorsa bunu parçalara bölmek de olası. Örneğin Amerika’nın Bağımsızlık Bildirgesi’ni sığdırmak için 18 tane E. coli bakterisine ihtiyaç duyuluyor. Ortalama olarak 1 gram ağırlığındaki bakterilerin alacağı veri miktarı ise yaklaşık 900 terabayt.

Bir Cevap Yazın